* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.

CC-5397 ∆aCRY-E10 mt+ [PH74]

Name: CC-5397 ∆aCRY-E10 mt+ [PH74]
SKU: CC-5397
Price: 30.00 USD
Availability: InStock

$30.00

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, February 2018 and Wenshuang Li, Maria Mittag lab, Friedrich Schiller University-Jena.

This is a aCRY disruption strain, generated with CRISPR/Cas9.

Note: Immunoblotting with aCRY antibody indicated small residual levels of aCRY protein.

Background strain   SAG 73.72 (= CC-3348)
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVIII (pPH075)
Target gene                           aCRY, Cre06.g278251
Target sequence GCTGTGTTTTGAGCACGACACGG (Exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

CC-5397 ∆aCRY-E10 mt+ [PH74]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart