* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.
CC-5440 ∆UVR8-I8-E4 mt- [PH050]
$30.00
Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018
This is a UVR8 disruption strain, generated with CRISPR/Cas9.
Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: UVR8, Cre05.g230600
Target sequence: CGAGGACAGATCTACAGCTGGGG (Exon 2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518