CC-6372 ∆ChR1 [PH085]

$30.00

From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2026

This is a ChR1 disruption strain, generated with CRISPR/Cas9 in the CC-125 background.

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.