From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

SAGA2 (Cre09.g394621) coding sequence plus 2216 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag. Transformed into C. reinhardtii strain CMJ030 to produce CC-5655.

Host strain: DH10B
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin

Sequence


https://www.biorxiv.org/content/10.1101/2020.08.16.252858v1.full

From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

Recombineering plasmid designed for generating C-terminal CrVenusYFP-3xFLAG fusion proteins. Contains the counter-selection ccdB gene that is toxic to bacteria not expressing ccdA.

The primers below can be used to amplify a cassette from the plasmid that excludes ccdB. A gene of interest can then be cloned into the cassette in-frame with CrVenusYFP-3xFLAG by recombineering.

Forward primer (5’-3’): GGAGATCTGGGTGGCTCCG
Reverse primer (5’-3’): GAAGATCCTTTGATCTTTTCTACGGG
These primer sequences should be appended to the 3’ end of gene-specific homology regions.

Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin

Sequence


https://www.biorxiv.org/content/10.1101/2020.05.06.080416v1

From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

Recombineering plasmid containing the λ phage cassette under an L-arabinose inducible promoter and the temperature-sensitive SC101 origin of replication. Should be grown at 30°C, λ phage cassette expression activated at 37°C.

Host strain: DH5α
Selection in E. coli: tetracycline

pRed (a.k.a. pLM072) was a gift to Luke Mackinder from Mihail Sarov (Max Planck Institute, Dresden, Germany), see the following publication for details: https://www.nature.com/articles/nmeth933

Sequence


Wang J, Sarov M, Rientjes J, Fu J, Hollak H, Kranz H, Xie W, Stewart AF, Zhang Y. An improved recombineering approach by adding RecA to lambda Red recombination. Mol Biotechnol. 2006 Jan;32(1):43-53. doi: 10.1385/mb:32:1:043. PMID: 16382181.

From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

Recombineering plasmid designed for generating C-terminal mNeonGreen-3xFLAG fusion proteins.

Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin


https://www.biorxiv.org/content/10.1101/2020.05.06.080416v1

From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

Recombineering plasmid designed for generating C-terminal CrVenusYFP-3xFLAG fusion proteins.

Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: hygromycin

Sequence


https://www.biorxiv.org/content/10.1101/2020.05.06.080416v1

From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

Recombineering plasmid designed for generating C-terminal mScarlet-i-3xFLAG fusion proteins.

Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: hygromycin

Sequence


https://www.biorxiv.org/content/10.1101/2020.05.06.080416v1

From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020

Recombineering plasmid designed for generating C-terminal mTurquoise2-3xHA fusion proteins.

Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: zeocin

Sequence


https://www.biorxiv.org/content/10.1101/2020.05.06.080416v1