From Tyler Wittkopp, Joseph Noel Lab, The Salk Institute for Biological Studies, March 2018


Wittkopp TM, Saroussi S, Yang W, Johnson X, Kim RG, Heinnickel ML, Russell JJ, Phuthong W, Dent RM, Broeckling CD, Peers G, Lohr M, Wollman FA, Niyogi KK, Grossman AR (2018) GreenCut protein CPLD49 of Chlamydomonas reinhardtii associates with thylakoid membranes and is required for cytochrome b(6) f complex accumulation. Plant J. 94:1023-1037


  • Locus:
  • CPLD38, CPLD49
  • Chromosome:
  • 1, 16

From Tyler Wittkopp, Joseph Noel Lab, The Salk Institute for Biological Studies, March 2018


Wittkopp TM, Schmollinger S, Saroussi S, Hu W, Zhang W, Fan Q, Gallaher SD, Leonard MT, Soubeyrand E, Basset GJ, Merchant SS, Grossman AR, Duanmu D, Lagarias JC (2017) Bilin-Dependent Photoacclimation in Chlamydomonas reinhardtii. Plant Cell 29:2711-2726


  • Locus:
  • HMOX1
  • Chromosome:
  • 10

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

The dyf13 mutant was obtained by UV-mutagenesis and screening for slow-swimming cells in the Kamiya lab at the University of Tokyo. DYF13 encodes an IFT complex B protein, IFT56/DYF13.


Ishikawa H, Ide T, Yagi T, Jiang X, Hirono M, Sasaki H, Yanagisawa H, Wemmer KA, Stainier DY, Qin H, Kamiya R, Marshall WF (2014) TTC26/DYF13 is an intraflagellar transport protein required for transport of motility-related proteins into flagella. Elife 3:e01566


  • Locus:
  • DYF13
  • Chromosome:

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

The dyf13 mutant was obtained by UV-mutagenesis and screening for slow-swimming cells in the Kamiya lab at the University of Tokyo. DYF13 encodes an IFT complex B protein, IFT56/DYF13.


Ishikawa H, Ide T, Yagi T, Jiang X, Hirono M, Sasaki H, Yanagisawa H, Wemmer KA, Stainier DY, Qin H, Kamiya R, Marshall WF (2014) TTC26/DYF13 is an intraflagellar transport protein required for transport of motility-related proteins into flagella. Elife 3:e01566


  • Locus:
  • DYF13
  • Chromosome:

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

This mutant was created by crossing pf18 (CC-1036) to fla3 KAP-GFP (CC-4296). This strain has the mutant pf18 and fla3 alleles.


Mueller J, Perrone CA, Bower R, Cole DG, Porter ME (2005) The FLA3 KAP subunit is required for localization of kinesin-2 to the site of flagellar assembly and processive anterograde intraflagellar transport. Mol Biol Cell 16:1341–1354

Engel BD, Lechtreck KF, Sakai T, Ikebe M, Witman GB, Marshall WF (2009) Total Internal Reflection Fluorescence (TIRF) Microscopy of Chlamydomonas Flagella. Methods Cell Biol 93:157-177

Engel BD, Ludington WB, Marshall WF (2009) Intraflagellar transport particle size scales inversely with flagellar length: revisiting the balance-point length control model. J Cell Biol 187:81–89


  • Locus:
  • PF18, FLA3
  • Chromosome:
  • 02, 10

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

This mutant was created by crossing pf18 with IFT27-GFP. IFT27-GFP is weakly expressed.


Qin H, Diener DR, Geimer S, Cole DG, Rosenbaum JL (2004) Intraflagellar transport (IFT) cargo: IFT transports flagellar precursors to the tip and turnover products to the cell body. J Cell Biol 164:255–266

Engel BD, Lechtreck KF, Sakai T, Ikebe M, Witman GB, Marshall WF (2009) Total Internal Reflection Fluorescence (TIRF) Microscopy of Chlamydomonas Flagella. Methods Cell Biol 93:157-177

Engel BD, Ludington WB, Marshall WF (2009) Intraflagellar transport particle size scales inversely with flagellar length: revisiting the balance-point length control model. J Cell Biol 187:81–89


  • Locus:
  • PF18
  • Chromosome:
  • 02

From Emily Hunter, Sale laboratory, Emory University, March 2018

This strain is transformant # 13-13-12. This cell-type has an ida3+ background and has been transformed with an IDA3-HA vector. The HA-tag is embedded within the second exon of IDA3. This cell-type is Hygromycin resistant.


Hunter EL, Lechtreck K, Fu G, Hwang J, Lin H, Gokhale A, Alford LM, Lewis B, Yamamoto R, Kamiya R, Yang F, Nicastro D, Dutcher SK, Wirschell M, Sale WS (2018) The IDA3 adapter, required for IFT transport of I1 dynein, is regulated by ciliary length. Mol Biol Cell. Feb 21. [Epub ahead of print] PubMed PMID: 29467251


  • Locus:
  • IDA3
  • Chromosome:
  • 03

From Emily Hunter, Sale laboratory, Emory University, March 2018

This strain is transformant # 15-3-14. This cell-type has an ida3+ background and has been transformed with an IDA3-mNeonGreen vector. The NG-tag is embedded within the second exon of IDA3. This cell-type is hygromycin resistant.

Note: 15-3-14 was used for imaging in Hunter et al., 2018.


Hunter EL, Lechtreck K, Fu G, Hwang J, Lin H, Gokhale A, Alford LM, Lewis B, Yamamoto R, Kamiya R, Yang F, Nicastro D, Dutcher SK, Wirschell M, Sale WS (2018) The IDA3 adapter, required for IFT transport of I1 dynein, is regulated by ciliary length. Mol Biol Cell. Feb 21. [Epub ahead of print] PubMed PMID: 29467251


  • Locus:
  • IDA3
  • Chromosome:
  • 03

From Emily Hunter, Sale laboratory, Emory University, March 2018

This cell-type contains the ida7 mutation, the ida3 mutation, and a wild-type copy of IDA3-NG. This cell line is Hygromycin resistant. This cell-line was obtained by mating ida7 x ida3; IDA3-NG followed by tetrad analysis. Susan Dutcher assisted in the mating and isolation of this cell-type. This cell-type prefers L-media.


Hunter EL, Lechtreck K, Fu G, Hwang J, Lin H, Gokhale A, Alford LM, Lewis B, Yamamoto R, Kamiya R, Yang F, Nicastro D, Dutcher SK, Wirschell M, Sale WS (2018) The IDA3 adapter, required for IFT transport of I1 dynein, is regulated by ciliary length. Mol Biol Cell. Feb 21. [Epub ahead of print] PubMed PMID: 29467251


  • Locus:
  • IDA3, IDA7
  • Chromosome:
  • 03, 16

From Sunghoon Jang, Youngsook Lee Lab, POSTECH-South Korea, April 2018

This strain has a CC-503 cw92 mt+ background and has been transformed with an AphVII cassette. The cassette is embedded within the fourth exon of MEX1. This strain is Hygromycin resistant.


Sunghoon J, Yamaoka Y, Ko Dh, Kurita T, Kim K, Song WY, Hwang JU, Kang BH, Nishida I, Lee Y (2015) Characterization of a Chlamydomonas reinhardtii mutant defective in a maltose transporter. Journal of plant biology. 58:344-351


  • Locus:
  • MEX1
  • Chromosome:
  • 12

From George Witman, UMASS Medical School, August 2018

This strain, which shows strong negative phototaxis and whose nucleus is easily transformed, is the parent strain for many of the insertional mutants generated in the Witman lab. It is a cross of nit1-305 (from J. Rosenbaum) to CC-124.


Pazour GJ, Sineshchekov OA, Witman GB (1995) Mutational analysis of the phototransduction pathway of Chlamydomonas reinhardtii. J Cell Biol. 131:427-40


  • Locus:
  • NIT1, AGG1
  • Chromosome:
  • 09, 13

From Takeshi Ohama, Kochi University of Technology-Japan, September 2018

This strain is good for overexpression of various transgenes. This is probably due to the relieved transcriptional repression.


Kurniasih SD, Yamasaki T, Kong F, Okada S, Widyaningrum D, Ohama T (2016) UV-mediated Chlamydomonas mutants with enhanced nuclear transgene expression by disruption of DNA methylation-dependent and independent silencing systems. Plant Mol Biol. 92:629-641

From Takeshi Ohama, Kochi University of Technology-Japan, September 2018

This strain is good for overexpression of various transgenes. This is probably due to the relieved transcriptional repression.


Kurniasih SD, Yamasaki T, Kong F, Okada S, Widyaningrum D, Ohama T (2016) UV-mediated Chlamydomonas mutants with enhanced nuclear transgene expression by disruption of DNA methylation-dependent and independent silencing systems. Plant Mol Biol. 92:629-641

From Takeshi Ohama, Kochi University of Technology-Japan, September 2018

This strain is good for overexpression of various transgenes. This is probably due to the relieved transcriptional repression.


Kurniasih SD, Yamasaki T, Kong F, Okada S, Widyaningrum D, Ohama T (2016) UV-mediated Chlamydomonas mutants with enhanced nuclear transgene expression by disruption of DNA methylation-dependent and independent silencing systems. Plant Mol Biol. 92:629-641

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PSR1 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         PSR1, Cre12.g495100
Target sequence                ACTAGCACCGAGCGTTGGCACGG (Exon1)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP8 (HKR4) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-3403 (mt-)
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pHR11
Target gene                              COP8 (HKR4), Cre07.g329900
Target sequence                     GGTGCAGGTCCAGCTTGCTGCGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP8 (HKR4) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-3403 (mt-)
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pHR11
Target gene                              COP8 (HKR4), Cre07.g329900
Target sequence                     GGTGCAGGTCCAGCTTGCTGCGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP11 (HKR7) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP11 (HKR7), Cre17.g733150
Target sequence                     GGTCTGTCATCGCAATGACGGGG (Exon 3)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP11 (HKR7) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP11 (HKR7), Cre17.g733150
Target sequence                     GGTCTGTCATCGCAATGACGGGG (Exon 3)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT disruption strain, generated with CRISPR/Cas9.

Background strain                 SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              PHOT, Cre03.g199000
Target sequence                     GACTGGATATGGACCCGATGAGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT disruption strain, generated with CRISPR/Cas9.

Background strain                 SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              PHOT, Cre03.g199000
Target sequence                     GACTGGATATGGACCCGATGAGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP6 (HKR2) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              COP6 (HKR2), Cre11.g467678
Target sequence                     GTTGTCTTCGAACAAGAGCGAGG (Exon3)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
 
This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP6 (HKR2) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              COP6 (HKR2), Cre11.g467678
Target sequence                     GTTGTCTTCGAACAAGAGCGAGG (Exon3)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
 
This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              VGCC, g11458
Target sequence                     GAATGTAGGAGCCCTTCCCGCGG (Exon 4)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

 


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              VGCC, g11458
Target sequence                     GATCAAACCCCGCAAGTACGAGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         VGCC, g11458

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pArg
Target gene                         VGCC, g11458

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         COP5, Cre02.g074150
Target sequence                GCAGCACCTCCAGACTGACGCGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         COP5, Cre02.g074150
Target sequence                GGTGTACTCGGTGATGCTGGCGG (Exon 4)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         UVR8, Cre05.g230600
Target sequence                CGAGGACAGATCTACAGCTGGGG (Exon 2)

  

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518