pCrU6.4-SpPSY1/aphVIII (pPH332)

$30.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin October 2017

Vector for single guide RNA targeting the phytoene synthase gene PSY1 with RNA scaffold for Streptococcus pyogenes Cas9 (SpCas9), controlled by the U6 snRNA promoter #4. Vector contains an aphVIII cassette for selection on paromomycin.

Target: PSY1 (Cre02.g095092)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGG

Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)

Overview of all CRISPR/Cas9 plasmids from the Hegemann lab

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659