* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.

pCrU6.4-SpPSY1/aphVIII (pPH332)

$30.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin October 2017

Vector for single guide RNA targeting the phytoene synthase gene PSY1 with RNA scaffold for Streptococcus pyogenes Cas9 (SpCas9), controlled by the U6 snRNA promoter #4. Vector contains an aphVIII cassette for selection on paromomycin.

Target: PSY1 (Cre02.g095092)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGG

Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)

Overview of all CRISPR/Cas9 plasmids from the Hegemann lab

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659

pCrU6.4-SpPSY1/aphVIII (pPH332)

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart