CC-5885 ∆pCRY-H5-1-C12 [PH260]

$30.00

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022

This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9. 

Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.