* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-5886 ∆pCRY-H5-3-C1 [PH261]
$30.00
Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022
This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.
Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.