* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-6053 ∆Cop6 in Sag 11-32b [PH278]
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a disrupted COP6 (HKR2). The strain was generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: COP6 (HKR2), Cre11.g467678
Target sequence: GTTGTCTTCGAACAAGAGCG
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.