pAPN_noAB-ARMC2-BSD-ccdB
$30.00
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Host strain: E. coli: DB3.1
Selection in E. coli: Ampicillin
Vector: ColE1 derivate
Insert: BSD (Blasticidin S Deaminase, Blasticidin S resistance)
Base vectors for easy construction of co-targeting CRISPR donor plasmids with exchangeable selectable marker genes under the control of a RbcS2 promotor/intron/terminator. The resistance is targeted to ARMC2 (guide RNA CTGACGACCGTAGTCCGCTGGGG) which results in paralyzed flagella with the distal part of the central pair complex missing. These vectors are digested with NruI and re-assembled by Gibson assembly with add a fusion fragment with homology arms as a primary integration. The final construct is prepared for transformation by digestion with BspQI followed by column purification.
For other resistances see pAPN_noAB-ARMC2-NAT-ccdB and pAPN_noAB-ARMC2-AphVIII-ccdB
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.