CC-5397 ∆aCRY-E10 mt+ [PH74]
$30.00
Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, February 2018 and Wenshuang Li, Maria Mittag lab, Friedrich Schiller University-Jena.
This is a aCRY disruption strain, generated with CRISPR/Cas9.
Note: Immunoblotting with aCRY antibody indicated small residual levels of aCRY protein.
Background strain              SAG 73.72 (= CC-3348)
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVIII (pPH075)
Target gene                           aCRY, Cre06.g278251
Target sequence                  GCTGTGTTTTGAGCACGACACGG (Exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10