CC-5433 ∆VGCC-B9 mt+ [PH063]
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018
This is a VGCC disruption strain, generated with CRISPR/Cas9.
Background strain:	CC-125 mt+
Nuclease:	(Sp)Cas9 as ribonucleoprotein (RNP)
Marker:	pAphVII (pPH360)
Target gene:	VGCC, g11458
Target sequence:	GAATGTAGGAGCCCTTCCCGCGG (Exon 4)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518