CC-5499 ∆ChR1 ∆ChR2 [PH128]

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2019

This is a ChR1 /ChR2 disruption strain, generated with CRISPR/Cas9.

Background strain: CC-125
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (p114), pAPHVII (p360)
Target gene: ChR1 (COP3), Cre14.g611300; ChR2 (COP4), Cre02.g085257
Target sequence: ChR1: TGTGGCTTCGTTACGCGGAGTGG (Exon5); ChR2: GCTCGCGCCCAACGGCACTCAGG (Exon1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.


  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2
  • Mutation Information:
  • Predicted Mutation Effect:

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.