CC-5541 ∆4-IPT-A10 mt+ [PH220]

$30.00

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a 4-IPT disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: 4-IPT, Cre17.g717350
Target sequence: GGTGATTGTGACGGGGCCCA CGG (Exon 1)

This strain was generated in a collaboration with Prof. Thomas Roitsch.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • 4-IPT
  • Chromosome:
  • 17
  • Mutation Information:
  • Predicted Mutation Effect: