* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-5543 ∆CiliK-D1 mt+ [PH170]
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)
This strain was generated in a collaboration with Prof. William Snell.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.