CC-5543 ∆CiliK-D1 mt+ [PH170]

$30.00

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)

This strain was generated in a collaboration with Prof. William Snell.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • CiliK/GCLK1
  • Chromosome:
  • 2
  • Mutation Information:
  • Predicted Mutation Effect: