CC-5547 ∆ChR1-M6-E12-3 mt- [PH166]

$30.00

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pARG (pHR11)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • ChR1
  • Chromosome:
  • 14
  • Mutation Information:
  • Predicted Mutation Effect: