* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.

CC-5557 ∆ChR1∆ChR2-Zif-F4 mt+ [PH178]

Name: CC-5557 ∆ChR1∆ChR2-Zif-F4 mt+ [PH178]
SKU: CC-5557
Availability: InStock

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9 and Zinc-finger nuclease.

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Zinc-finger nuclease (ZFN)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Locus:
ChR1, ChR2
Chromosome:
14, 2
Mutation Information:
Predicted Mutation Effect:

CC-5557 ∆ChR1∆ChR2-Zif-F4 mt+ [PH178]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart