CC-5673 ROC15-Luc+ ∆pCRY-C64 [PH213]

$30.00

Deposited by Simon Kelterborn and Philipp Sachse, Peter Hegemann lab, Humboldt University of Berlin, November 2020

This is a pCRY disruption in a ROC15-Luc+ reporter strain, generated with CRISPR/Cas9. Clone C64

Background strain: ROC15-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY, (Cre06.g295200)
Target sequence: GCGACATGCTGTATGAGCCG TGG (exon 2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.