* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-5675 ∆ChR1 [PH209]
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR1 disruption strain, generated with CRISPR/Cas9.
Background strain: CC-124 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.