* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.

CC-5787 ∆POLQ-E2 mt+ [PH152]

Name: CC-5787 ∆POLQ-E2 mt+ [PH152]
SKU: CC-5787
Availability: InStock

$30.00

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin,
December 2021

This is a POLQ disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC-3403 [PH55].

Background strain: CC-3403, ChR1 disruption strain [PH55]
Nuclease: SpCas9
Target gene: POLQ Cre16.g664300
Target sequence: GCATCAGTTGATGGTGACGG
Marker: pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

CC-5787 ∆POLQ-E2 mt+ [PH152]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart