CC-5787 ∆POLQ-E2 mt+ [PH152]

$30.00

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin,
December 2021

This is a POLQ disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC-3403 [PH55].

Background strain: CC-3403, ChR1 disruption strain [PH55]
Nuclease: SpCas9
Target gene: POLQ Cre16.g664300
Target sequence: GCATCAGTTGATGGTGACGG
Marker: pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.