CC-5792 ∆POLQ-G2 mt+ [PH019]

$30.00

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a POLQ disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: POLQ Cre16.g664300
Target sequence: GCCGCGCCATCCACATTGCT
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.