CC-5887 D5-1 [PH55]

$30.00

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University of Berlin,
April 2022

This strain was generated by insertion of the gene targeting selection (GTS) construct ble:yfp:mut-aphVIII containing SpCas9 target sites for the human EMX1 homeobox protein gene (Ran et al., 2015) and for ChR1 specific zinc finger nuclease (ZFN) into CC-3403 strain.

Background strain: CC-3403
Target genes: inactivated gene of the paromomycin resistance mut-aphVIII
ChR1 Cre14.g611300

Target sequences: SpCas9: ACTCCCTGGCCAGGCTTTGGGGAGGCC
ChR1 ZFN: CCCTCCGCCATGAGCGCCGGCGGCCG

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab http://www.chlamy.de/strains


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.