* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.

CC-5887 D5-1 [PH55]

Name: CC-5887 D5-1 [PH55]
SKU: 87629
Availability: InStock

$30.00

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University of Berlin,
April 2022

This strain was generated by insertion of the gene targeting selection (GTS) construct ble:yfp:mut-aphVIII containing SpCas9 target sites for the human EMX1 homeobox protein gene (Ran et al., 2015) and for ChR1 specific zinc finger nuclease (ZFN) into CC-3403 strain.

Background strain: CC-3403
Target genes: inactivated gene of the paromomycin resistance mut-aphVIII
ChR1 Cre14.g611300

Target sequences: SpCas9: ACTCCCTGGCCAGGCTTTGGGGAGGCC
ChR1 ZFN: CCCTCCGCCATGAGCGCCGGCGGCCG

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.

CC-5887 D5-1 [PH55]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart