CC-5952 ∆Ku80-G10 [PH096]

$30.00

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a KU80 disruption strain, generated with SpCas9 based on the CC-125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9

Knock-out generated using CRISPR/Cas9 and FLAG sequence ATAATGACCACGACATCGACTACAAGGACT to disrupt the gene of interest.
Target gene: KU80, Cre10.g423800
Target sequence: ggcggcaggaccagcctgga
Marker: pAphVII (pPH360) 

This strain was not published. Please contact irinasiz@yahoo.com before using it.


  • Locus:
  • KU80, Cre10.g423800
  • Chromosome:
  • 10
  • Mutation Information:
  • Predicted Mutation Effect: