* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-5953 CC125-delRad51C-A10 [PH192]
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.
Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.