CC-5954 CC125-delRad51C-D12 [PH193]

$30.00

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360) 

This strain was not published. Please contact irinasiz@yahoo.com before using it.


  • Locus:
  • Rad51C, Cre02.g102500
  • Chromosome:
  • Mutation Information:
  • Predicted Mutation Effect: