CC-5957 D5-delRad51C-A3 [PH188]
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-5887 D5-1 [PH55] strain containing the gene targeting selection construct ble:yfp:mut-aphVIII. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCTAATTAGCGTGGGCGCGTGAG to disrupt the gene of interest. It contains the 185 bp insert including FLAG sequence + an unidentified DNA sequence at the disruption site.
Background strain: CC-5887 D5-1
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.