* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-5958 D5-delRad51C-C9 [PH189]
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-5887 D5-1 [PH55] strain containing the gene targeting selection construct ble:yfp:mut-aphVIII. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCTAATTAGCGTGGGCGCGTGAG to disrupt the gene of interest. It contains the 55 bp insert including FLAG sequence + the 25 bp fragment of the chromosomal DNA at the disruption site.
Background strain: CC-5887 D5-1
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.