* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.

CC-5959 ChR1-E162T [PH106]

Name: CC-5959 ChR1-E162T [PH106]
SKU: CC-5959
Availability: InStock

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a strain with a point mutation E162T in ChR1, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E162T exchange in ChR1

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Locus:
ChR1, Cre14.g611300
Chromosome:
14
Mutation Information:
Predicted Mutation Effect:

CC-5959 ChR1-E162T [PH106]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart