CC-5959 ChR1-E162T [PH106]

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a strain with a point mutation E162T in ChR1, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300 
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E162T exchange in ChR1


Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.


  • Locus:
  • ChR1, Cre14.g611300
  • Chromosome:
  • 14
  • Mutation Information:
  • Predicted Mutation Effect:

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.