CC-5960 ∆ChR1(E162) ∆ChR2(E123) [PH156]

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 and ChR2 disruption strain, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 AGTGGTTGCGTTACGCCGAG (exon 6)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1 and ChR2


Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.


  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2
  • Mutation Information:
  • Predicted Mutation Effect:

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.