CC-5969 ∆SNRK2.2-C10 [PH159]
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C10-A10.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.