CC-6051 ChR1-E162T, ∆ChR2 [PH180]
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E162T in ChR1 and disrupted ChR2. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+, CC5959 (PH106)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75); pCrZ3 (pPH68)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.