CC-6177 SAG 73-72 ∆pCry [PH256]

$30.00

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9. The pCRY strain contains an insertion of the marker plasmid pAphVIII (pPH75).

Background strain: SAG 73-72 (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GCGACATGCTGTATGAGCCG (Exon2)

This is an unpublished strain. Please contact ph@chlamy.de before using it.