* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-6178 SAG73-72 ∆pCry [PH257]
$30.00
Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 73-72 (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GCGACATGCTGTATGAGCCG (Exon2)
This is an unpublished strain. Please contact ph@chlamy.de before using it.