CC-6179 ChR2-C128T, ∆ChR1 (E162) [PH245]

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a strain with a mutated C128 residue to T128 in ChR2 ( = point mutation C128T) and disruption of ChR1, which was generated with SpCas9 in the CC-125 background.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)
Marker: pAPHVIII (pPH75); pAphVII (pPH360)

This is an unpublished strain. Please contact ph@chlamy.de before using it.