* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-6179 ChR2-C128T, ∆ChR1 (E162) [PH245]
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is a strain with a mutated C128 residue to T128 in ChR2 ( = point mutation C128T) and disruption of ChR1, which was generated with SpCas9 in the CC-125 background.
Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)
Marker: pAPHVIII (pPH75); pAphVII (pPH360)
This is an unpublished strain. Please contact ph@chlamy.de before using it.