* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-6180 ∆AGG3 in SAG32-11b [PH281]
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is an AGG3 disruption strain, generated with SpCas9 in the SAG 11-32b background.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: SpCas9
Target gene: AGG3, Cre10.g456100
Target sequence: GAAGCCGAACACGAAGCCAT
Marker: pAPHVIII (pPH75)
This is an unpublished strain. Please contact ph@chlamy.de before using it.