* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
pAPN_IFT46-mScarletI_DRC4-PAR_cotarget
$30.00
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Selection in E. coli: Ampicillin
Host strain: E. coli: DH5α
Insert: c-ter homology arms for IFT46, mScarletI, homology arms for DRC4 disruption.
Vector: pAPN_AphVIII
Donor plasmid used to make CC-6014 with guides GAGATGGAGAACAAGCTGGACGG (IFT46) and CAACATCACGACGTTGAAGTCG (DRC4). Prepared for transformation by digestion with BspQI.
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.