pAPN_mNGi-TUA1-ki_DRC4-PAR_cotarget
$30.00
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Selection in E. coli: Ampicillin
Host strain: E. coli: DH5α
Insert: n-ter homology arms for TUA1, mNeonGreen with introns, TUA1 n-ter fragments, homology arms for DRC4 disruption.
Vector: pAPN_AphVIII
Donor plasmid used to make CC-6014 with guides GAGGAGACGGAGAAAATCAGGGG, CTGTCAACTGACCTGGATACCGG (TUA1) and CAACATCACGACGTTGAAGTCG (DRC4). Prepared for transformation by digestion with BspQI.
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.