pLM099
$30.00
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
Recombineering plasmid designed for generating C-terminal CrVenusYFP-3xFLAG fusion proteins. Contains the counter-selection ccdB gene that is toxic to bacteria not expressing ccdA.
The primers below can be used to amplify a cassette from the plasmid that excludes ccdB. A gene of interest can then be cloned into the cassette in-frame with CrVenusYFP-3xFLAG by recombineering.
Forward primer (5’-3’): GGAGATCTGGGTGGCTCCG
Reverse primer (5’-3’): GAAGATCCTTTGATCTTTTCTACGGG
These primer sequences should be appended to the 3’ end of gene-specific homology regions.
Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin
Emrich-Mills TZ, Yates G, Barrett J, Girr P, Grouneva I, Lau CS, Walker CE, Kwok TK, Davey JW, Johnson MP, Mackinder LCM. A recombineering pipeline to clone large and complex genes in Chlamydomonas. Plant Cell. 2021 May 31;33(4):1161-1181. doi: 10.1093/plcell/koab024. PMID: 33723601; PMCID: PMC8633747.