Search Results for 11/32C
This strain was obtained by David Grant from Uwe G. Schlösser, Sammlung von Algenkulturen (SAG), while David was at the University of Chicago, and was brought to Duke University by him. It was originally accessioned by SAG as “Lewin Caroline Islands strain” but its chloroplast DNA is indistinguishable from that of the standard laboratory strain of C. reinhardtii. Ferris reported that its distribution of the Gulliver transposon is also consistent with its being an isolate of the standard strain.
Christoph Beck reported this strain did not mate with his 137c or CC-1373 11/86, whereas our tests showed good mating with CC-125.
Ferris PJ (1989) Characterization of a Chlamydomonas transposon, Gulliver, resembling those in higher plants. Genetics 122:363-377
Pröschold T, Harris EH, Coleman AW (2005) Portrait of a species: Chlamydomonas reinhardtii. Genetics 170:1601-1610
This strain was obtained by David Grant from Uwe G. Schlösser, Sammlung von Algenkulturen (SAG), while David was at the University of Chicago, and was brought to Duke University by him. It is equivalent to CC-1010 UTEX 90, and can grow on nitrate.
For more information on the origin of the standard laboratory strains of C. reinhardtii, please see the following paper:
Pröschold T, Harris EH, Coleman AW (2005) Portrait of a species: Chlamydomonas reinhardtii. Genetics 170:1601-1610
Sammlung von Algenkulturen (SAG), January 1985
This is a mutant with a hatching deficiency, isolated by U.G. Schlösser. It has not been analyzed genetically.
From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
CC-125 wild type mt+ [137c]
$30.00
$30.00
Boynton-Gillham laboratory, Duke University
This is the basic “137c” wild type strain originally from G.M. Smith, isolated in 1945 near Amherst MA, and is presumably equivalent to strain 11/32c of the Culture Centre of Algae and Protozoa. This particular strain was brought to Duke by N.W. Gillham in 1968 from R.P. Levine’s laboratory at Harvard.
CC-124 and CC-125 carry the nit1 and nit2 mutations, and cannot grow on nitrate as their sole N source. CC-125 carries the AGG1 (agg1+) allele for phototactic aggregation, in contrast to CC-124, which has the agg1 allele at this locus.
CC-125 is the background strain for many mutations, including CC-503 cw92 mt+ which was the source of DNA used for genomic sequencing.
For more information on the origin of the standard laboratory strains of C. reinhardtii, please see the following paper:
Pröschold T, Harris EH, Coleman AW (2005) Portrait of a species: Chlamydomonas reinhardtii. Genetics 170:1601-1610
CC-5151 fla12 cnk11-3
$30.00
$30.00
From Susan Dutcher, Washington University in St. Louis, September 2015
This strain was generated from a cross between fla12 and cnk11-3. It partially rescues the temperature sensitive phenotype of fla12 at 32 °C. It cannot suppress the motility defect.
Lin H, Zhang Z, Guo S, Chen F, Kessler JM, Wang YM, Dutcher SK (2015) A NIMA-Related Kinase Suppresses the Flagellar Instability Associated with the Loss of Multiple Axonemal Structures. PLoS Genet. Sep 8;11(9):e1005508
From Robert J. Spreitzer, University of Nebraska, August 2014
Phenotype: requires acetate, sensitive to light
Following 5-fluorodeoxyuridine treatment and ethyl-methanesulfonate mutagenesis of wild-type 2137 mt+ cells, colonies were screened for light-sensitive, acetate-requiring phenotypes (Spreitzer and Mets 1981). Mutant 11-1A displayed uniparental inheritance, and lacks photosystem II activity (Spreitzer and Mets 1981). Recombination tests showed that 11-1A is at the same locus (pst-u-1) as 8-36C, 10-4, 11-3D, 11-4D, and 12-3C (Spreitzer and Ogren 1983a). Mutants 8-36C, 11-1A, and 11-4D were shown to result from deletions in psbA (Bennoun et al 1986). However, the extent of the deletions in 11-1A and 11-4D differs from that in 8-36C and FUD7 (CC-4147) (Bennoun et al 1986). This strain was recovered from a cross between the original 11-1A mt+ (CC-2051) and pf2 mt- (from Levine), and has been maintained with acetate medium in darkness since 1980 to prevent selection for revertants and non-light-sensitive suppressors (Spreitzer and Ogren 1983b).
Chromosome: chloroplast
Locus: psbA
Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol Biol 6:151-160
Spreitzer RJ, Mets L (1981) Photosynthesis-deficient mutants of Chlamydomonas with associated light-sensitive phenotypes. Plant Physiol 67:565-569
Spreitzer RJ, Ogren WL (1983a) Rapid recovery of chloroplast mutations affecting ribulosebisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 80:6293-6297
Spreitzer RJ, Ogren WL (1983b) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
From Robert J. Spreitzer, University of Nebraska, August 2014
Phenotype: requires acetate, sensitive to light
Following 5-fluorodeoxyuridine treatment and ethyl-methanesulfonate mutagenesis of wild-type 2137 mt+ cells, colonies were screened for light-sensitive, acetate-requiring phenotypes (Spreitzer and Mets 1981). Mutant 11-4D displayed uniparental inheritance, and lacks photosystem II activity (Spreitzer and Mets 1981). Recombination tests showed that 11-4D is at the same locus (pst-u-1) as 8-36C, 10-4, 11-1A, 11-3D, and 12-3C (Spreitzer and Ogren 1983a). Mutants 8-36C, 11-1A, and 11-4D were shown to result from deletions in psbA (Bennoun et al 1986). However, the extent of the deletions in 11-1A and 11-4D differs from that in 8-36C and FUD7 (CC-4147) (Bennoun et al 1986). This strain was recovered from a cross between the original 11-4D mt+ and pf2 mt- (from Levine), and has been maintained with acetate medium in darkness since 1980 to prevent selection for revertants and non-light-sensitive suppressors (Spreitzer and Ogren 1983b).
Chromosome: chloroplast
Locus: psbA
Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol Biol 6:151-160
Spreitzer RJ, Mets L (1981) Photosynthesis-deficient mutants of Chlamydomonas with associated light-sensitive phenotypes. Plant Physiol 67:565-569
Spreitzer RJ, Ogren WL (1983a) Rapid recovery of chloroplast mutations affecting ribulosebisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 80:6293-6297
Spreitzer RJ, Ogren WL (1983b) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
From Robert J. Spreitzer, University of Nebraska, August 2014
Phenotype: requires acetate, sensitive to light
Following 5-fluorodeoxyuridine treatment and ethyl-methanesulfonate mutagenesis of wild-type 21gr mt+ cells, colonies were screened for light-sensitive, acetate-requiring phenotypes (Spreitzer and Mets 1981). Mutant 8-36C displayed uniparental inheritance, and lacks photosystem II activity (Spreitzer and Mets 1981). Recombination tests showed that 8-36C is at the same locus (pst-u-1) as 10-4, 11-1A, 11-3D, 11-4D, and 12-3C (Spreitzer and Ogren 1983a). Because the 8-36C mutation was shown to be linked with a mutation conferring herbicide resistance (Galloway and Mets 1984), subsequent studies confirmed that 8-36C results from a deletion in the psbA gene similar to that of FUD7 (CC-4147) (Bennoun et al 1986). This strain was recovered from a cross between the original 8-36C mt+ and pf2 mt- (from Levine), and has been maintained with acetate medium in darkness since 1980 to prevent selection for revertants and non-light-sensitive suppressors (Spreitzer and Ogren 1983b).
Chromosome: chloroplast
Locus: psbA
Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol Biol 6:151-160
Galloway RE, Mets L (1984) Atrazine, bromacil, and diuron resistance in Chlamydomonas: A single non-mendelian genetic locus controls the structure of the thylakoid binding site. Plant Physiol 74:469-474
Spreitzer RJ, Mets L (1981) Photosynthesis-deficient mutants of Chlamydomonas with associated light-sensitive phenotypes. Plant Physiol 67:565-569
Spreitzer RJ, Ogren WL (1983a) Rapid recovery of chloroplast mutations affecting ribulosebisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 80:6293-6297
Spreitzer RJ, Ogren WL (1983b) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
From Robert J. Spreitzer, University of Nebraska, August 2014
Phenotype: requires acetate, sensitive to light
Following 5-fluorodeoxyuridine treatment and ethyl-methanesulfonate mutagenesis of wild-type 21gr mt+ cells, colonies were screened for light-sensitive, acetate-requiring phenotypes (Spreitzer and Mets 1981). Mutant 8-36C displayed uniparental inheritance, and lacks photosystem II activity (Spreitzer and Mets 1981). Recombination tests showed that 8-36C is at the same locus (pst-u-1) as 10-4, 11-1A, 11-3D, 11-4D, and 12-3C (Spreitzer and Ogren 1983a). Because the 8-36C mutation was shown to be linked with a mutation conferring herbicide resistance (Galloway and Mets 1984), subsequent studies confirmed that 8-36C results from a deletion in the psbA gene similar to that of FUD7 (CC-4147) (Bennoun et al 1986). This strain was recovered from a cross between the original 8-36C mt+ and pf2 mt- (from Levine), and has been maintained with acetate medium in darkness since 1980 to prevent selection for revertants and non-light-sensitive suppressors (Spreitzer and Ogren 1983b).
Chromosome: chloroplast
Locus: psbA
Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol Biol 6:151-160
Galloway RE, Mets L (1984) Atrazine, bromacil, and diuron resistance in Chlamydomonas: A single non-mendelian genetic locus controls the structure of the thylakoid binding site. Plant Physiol 74:469-474
Spreitzer RJ, Mets L (1981) Photosynthesis-deficient mutants of Chlamydomonas with associated light-sensitive phenotypes. Plant Physiol 67:565-569
Spreitzer RJ, Ogren WL (1983a) Rapid recovery of chloroplast mutations affecting ribulosebisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 80:6293-6297
Spreitzer RJ, Ogren WL (1983b) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
From Robert J. Spreitzer, University of Nebraska, August 2014
Phenotype: requires acetate, sensitive to light
Following 5-fluorodeoxyuridine treatment and ethyl-methanesulfonate mutagenesis of wild-type 2137 mt+ cells, colonies were screened for light-sensitive, acetate-requiring phenotypes (Spreitzer and Mets 1981). Mutant 11-3D displayed uniparental inheritance, and lacks photosystem II activity (Spreitzer and Mets 1981). Recombination tests showed that 11-3D is at the same locus (pst-u-1) as 8-36C, 10-4, 11-1A, 11-4D, and 12-3C (Spreitzer and Ogren 1983a). Because 8-36C, 11-1A, and 11-4D result from deletions in psbA (Bennoun et al 1986), 11-3D may also result from a psbA mutation. This strain was recovered from a cross between the original 11-3D mt+ (CC-2052) and pf2 mt- (from Levine), and has been maintained with acetate medium in darkness since 1980 to prevent selection for revertants and non-light-sensitive suppressors (Spreitzer and Ogren 1983b).
Chromosome: chloroplast
Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol Biol 6:151-160
Spreitzer RJ, Mets L (1981) Photosynthesis-deficient mutants of Chlamydomonas with associated light-sensitive phenotypes. Plant Physiol 67:565-569
Spreitzer RJ, Ogren WL (1983a) Rapid recovery of chloroplast mutations affecting ribulosebisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 80:6293-6297
Spreitzer RJ, Ogren WL (1983b) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
From Robert J. Spreitzer, University of Nebraska, August 2014
Phenotype: requires acetate, sensitive to light
Following 5-fluorodeoxyuridine treatment and ethyl-methanesulfonate mutagenesis of wild-type 2137 mt+ cells, colonies were screened for light-sensitive, acetate-requiring phenotypes (Spreitzer and Mets 1981). Mutant 10-4 displayed uniparental inheritance, and lacks photosystem II activity (Spreitzer and Mets 1981). Recombination tests showed that 10-4 is at the same locus (pst-u-1) as 8-36C, 11-1A, 11-3D, 11-4D, and 12-3C (Spreitzer and Ogren 1983a). Because 8-36C, 11-1A, and 11-4D result from deletions in psbA (Bennoun et al 1986), 10-4 may also result from a psbA mutation. This strain was recovered from a cross between the original 10-4 mt+ and pf2 mt- (from Levine), and has been maintained with acetate medium in darkness since 1980 to prevent selection for revertants and non-light-sensitive suppressors (Spreitzer and Ogren 1983b).
Chromosome: chloroplast
Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol Biol 6:151-160
Spreitzer RJ, Mets L (1981) Photosynthesis-deficient mutants of Chlamydomonas with associated light-sensitive phenotypes. Plant Physiol 67:565-569
Spreitzer RJ, Ogren WL (1983a) Rapid recovery of chloroplast mutations affecting ribulosebisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 80:6293-6297
Spreitzer RJ, Ogren WL (1983b) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
CC-1004 ac15 NIT+ mt-
$30.00
$30.00
Chlamydomonas Genetics Center, Duke University, May 1980
Phenotype: requires acetate
From a cross of CC-527 ac15 x CC-919 wild type 11/32b (NIT+) [no longer in the collection]
This strain provides the ac15 marker on linkage group IX with the wild type alleles of the linked marker NIT1 and the unlinked NIT2. It can grow on nitrate as its sole N source.
CC-5678 ∆ChR2-H12 [PH164]
$30.00
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
From Arminio Boschetti, University of Bern, August 2001
Phenotype: carotenoid deficient; requires arginine
The pg-101 or lor1 mutant was isolated by M. Tellenbach in Boschetti’s laboratory, by selecting cells with altered color after UV mutagenesis of an arg2 strain (CCAP 11/32f, Levine arg2 mt+). Tellenbach characterized it as deficient in loroxanthin. Subsequently Chunayev et al. showed that it was deficient in alpha cyclase, resulting in failure to produce the carotenoid epsilon rings.
Please see CC-2420 for additional information on this mutant.
This strain should be kept in dim light.
Chunayev AS, Mirnaya ON, Maslov VG, Boschetti A (1991) Chlorophyll b and chloroxanthin-deficient mutants of Chlamydomonas reinhardtii. Photosynthetica 25:291-301
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR1ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG
AGTGGTTGCGTTACGCCGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR1ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG
AGTGGTTGCGTTACGCCGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5430 ∆PHOT-A7 mt+ [PH136]
$30.00
$30.00
Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018
This is a PHOT disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: PHOT, Cre03.g199000
Target sequence: GACTGGATATGGACCCGATGAGG (Exon2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5429 ∆PHOT-A5 mt+ [PH135]
$30.00
$30.00
Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018
This is a PHOT disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: PHOT, Cre03.g199000
Target sequence: GACTGGATATGGACCCGATGAGG (Exon2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5552 ∆ChR2-H9 mt+ [PH165]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG TGG (exon 6)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5551 ∆ChR1-F1 mt+ [PH163]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR1 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5550 ∆ChR1-H6 mt+ [PH160]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR1 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-3872 pg-113 arg2 mt+
$30.00
$30.00
From Arminio Boschetti, University of Bern, August 2001
Phenotype: chlorophyll and carotenoid deficient; requires arginine
From Boschetti’s notes on this strain: The pg-113 mutant was isolated by M. Tellenbach in Boschetti’s laboratory, by selecting cells with altered color after UV mutagenesis of an arg2 strain (CCAP 11/32f, Levine arg2 mt+) and subsequently determined in collaboration with Alexander Chunayev to be an allele at the CBN1 locus although its phenotype differs somewhat from the cbn1-48 mutant that defines that locus. It lacks a stable chlorophyll complex and chlorophyll b, but has normal chlorophyll a., and the LHCII proteins are normal. The amount of neoxanthin is reduced. This strain grows phototrophically but should be kept at low to medium light intensity.
Michel H, Tellenbach M, Boschetti A (1983) A chlorophyll b-less mutant of Chlamydomonas reinhardii lacking in the light-harvesting chlorophyll complex but not in its apoproteins. Biochim Biophys Acta 725:417-424
Hoober JK, Maloney MA, Asbury LR, Marks DB (1990) Accumulation of Chlorophyll a/b-Binding Polypeptides in Chlamydomonas reinhardtii y-1 in the Light or Dark at 38 degrees C : Evidence for Proteolytic Control. Plant Physiol 92:419-426
Hoober JK, Hughes MJ (1992) Purification and Characterization of a Membrane-Bound Protease from Chlamydomonas reinhardtii. Plant Physiol 99:932-937
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)
This strain was generated in a collaboration with Prof. William Snell.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Boris Zorin, Peter Hegemann lab, Humboldt University-Berlin, February 2018
This is a phototropin disruption strain, generated with single stranded DNA.
Background strain CC-4350
Nuclease no
Marker pAPHVIII
Target gene Phototropin, PHOT, Cre03.g199000
Overview of other strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This strain is no longer available. If other ∆phot strains are needed, please see the other phototropin (PHOT) disruption strains:
in CC-125: CC-5391 ∆PHOT-C41 [PH13], CC-5392 ∆PHOT-B5 [PH15]
in SAG11-32b: CC-5429 ∆PHOT-A5 [PH135], CC-5430 ∆PHOT-A7 [PH136]
Zorin B, Lu Y, Sizova I, Hegemann P (2009) Nuclear gene targeting in Chlamydomonas as exemplified by disruption of the PHOT gene. Gene 432(1-2):91-6
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)
This strain was generated in a collaboration with Prof. William Snell.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-124 wild type mt- [137c]
$30.00
$30.00
Boynton-Gillham laboratory, Duke University
This is the basic “137c” wild type strain originally from G.M. Smith, isolated in 1945 near Amherst MA, and is presumably equivalent to strain 11/32d of the Culture Centre of Algae and Protozoa. This particular strain was brought to Duke by N.W. Gillham in 1968 from R.P. Levine’s laboratory at Harvard.
CC-124 and CC-125 carry the nit1 and nit2 mutations, and cannot grow on nitrate as their sole N source. CC-124 carries the agg1 allele for phototactic aggregation (see CC-1328 for more information), in contrast to CC-125, which has the agg1+ allele at this locus.
For more information on the origin of the standard laboratory strains of C. reinhardtii, please see the following paper:
Pröschold T, Harris EH, Coleman AW (2005) Portrait of a species: Chlamydomonas reinhardtii. Genetics 170:1601-1610
CC-5796 D4cia5/GYD mt-
$30.00
$30.00
From Antonia Schad, University of Leipzig, January 2022
This strain was obtained from a conventional crossing using two mutants: LMJ.SG0182.017965 (deficient in the gene for glycolate dehydrogenase) and CC-2702 cia5 (deficient in carbon concentrating mechanisms). Prior to this, both mutant strains were crossed with wild type strains to improve fitness: LMJ.SG0182.017965 x SAG 11-32b and CC-2702 cia5 x CC-410.
D4cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate. The strain requires elevated CO2 for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014).
Schad A, Rössler S, Nagel R, Wagner H, Wilhelm C. Crossing and selection of Chlamydomonas reinhardtii strains for biotechnological glycolate production. Appl Microbiol Biotechnol. 2022 May 5. doi: 10.1007/s00253-022-11933-y. Epub ahead of print. PMID: 35511277.
CC-5759 D6cia5/GYD
$30.00
$30.00
From Antonia Schad, University of Leipzig, July 2021
This strain was obtained from a conventional crossing using two mutants: LMJ.SG0182.017965 (deficient in the gene for glycolate dehydrogenase) and CC-2702 cia5 (deficient in carbon concentrating mechanisms). Prior to this, both mutant strains were crossed with wild type strains to improve fitness: LMJ.SG0182.017965 x SAG 11-32b and CC-2702 cia5 x CC-410.
The strain requires elevated CO2 for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014).
CMD6cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate.
Schad A, Rössler S, Nagel R, Wagner H, Wilhelm C. Crossing and selection of Chlamydomonas reinhardtii strains for biotechnological glycolate production. Appl Microbiol Biotechnol. 2022 May 5. doi: 10.1007/s00253-022-11933-y. Epub ahead of print. PMID: 35511277.
CC-5797 D5cia5/GYD mt+
$30.00
$30.00
From Antonia Schad, University of Leipzig, January 2022
This strain was obtained from a conventional crossing using two mutants: LMJ.SG0182.017965 (deficient in the gene for glycolate dehydrogenase) and CC-2702 cia5 (deficient in carbon concentrating mechanisms). Prior to this, both mutant strains were crossed with wild type strains to improve fitness: LMJ.SG0182.017965 x SAG 11-32b and CC-2702 cia5 x CC-410.
D5cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate. The strain requires elevated CO2 for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014).
Schad A, Rössler S, Nagel R, Wagner H, Wilhelm C. Crossing and selection of Chlamydomonas reinhardtii strains for biotechnological glycolate production. Appl Microbiol Biotechnol. 2022 May 5. doi: 10.1007/s00253-022-11933-y. Epub ahead of print. PMID: 35511277.