CC-5396 ∆aCRY-A3 mt+ [PH73]

$20.00

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, February 2018 and Wenshuang Li, Maria Mittag lab, Friedrich Schiller University-Jena.

This is a aCRY disruption strain, generated with CRISPR/Cas9.

Note: Immunoblotting with aCRY antibody indicated small levels of aCRY protein.

Background strain              SAG 73.72 (= CC-3348)
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVIII (pPH075)
Target gene                           aCRY, Cre06.g278251
Target sequence                  GCTGTGTTTTGAGCACGACACGG (Exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains 
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10