CC-5424 ∆PSR1-D10 mt+ [PH011]

$20.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PSR1 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         PSR1, Cre12.g495100
Target sequence                ACTAGCACCGAGCGTTGGCACGG (Exon1)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.