CC-5425 ∆COP8-E9D1 mt- [PH101]


From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP8 (HKR4) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-3403 (mt-)
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pHR11
Target gene                              COP8 (HKR4), Cre07.g329900
Target sequence                     GGTGCAGGTCCAGCTTGCTGCGG (Exon2)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.