CC-5427 ∆COP11-B9-1 mt+ [PH133]


From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP11 (HKR7) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP11 (HKR7), Cre17.g733150
Target sequence                     GGTCTGTCATCGCAATGACGGGG (Exon 3)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.