CC-5428 ∆COP11-B9-2 mt+ [PH134]

$20.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP11 (HKR7) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP11 (HKR7), Cre17.g733150
Target sequence                     GGTCTGTCATCGCAATGACGGGG (Exon 3)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.