CC-5429 ∆PHOT-A5 mt+ [PH135]


From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT disruption strain, generated with CRISPR/Cas9.

Background strain                 SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              PHOT, Cre03.g199000
Target sequence                     GACTGGATATGGACCCGATGAGG (Exon2)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.