CC-5432 ∆COP6-G4 mt+ [PH142]

$20.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP6 (HKR2) disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              COP6 (HKR2), Cre11.g467678
Target sequence                     GTTGTCTTCGAACAAGAGCGAGG (Exon3)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
 
This is an unpublished strain. Please contact ph@chlamy.de before using it.