CC-5433 ∆VGCC-B9 mt+ [PH063]


From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              VGCC, g11458
Target sequence                     GAATGTAGGAGCCCTTCCCGCGG (Exon 4)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518