* The listed price of $20.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $200.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.

CC-5434 ∆VGCC-C9 mt+ [PH064]

Name: CC-5434 ∆VGCC-C9 mt+ [PH064]
SKU: CC-5434
Price: 20.00 USD
Availability: InStock

$20.00

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9.

Background strain CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              VGCC, g11458
Target sequence                     GATCAAACCCCGCAAGTACGAGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

CC-5434 ∆VGCC-C9 mt+ [PH064]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart