CC-5439 ∆UVR8-I7-E12 mt- [PH048]

$20.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         UVR8, Cre05.g230600
Target sequence                CGAGGACAGATCTACAGCTGGGG (Exon 2)

  

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518